Lab #4 BLAST By Karley Quibilan


1. The protein I’ve searched for is verotoxin, closely related with E. coli, out of my own curiosity to find natural occurring proteins that are harmful to us.

2. Verotoxin 1 uncultured bacterium is found in cattle feces and can be easily transmitted to humans. This toxin is one of the deadliest proteins that can interfere with the production of small blood vessels in our kidneys and GI tract causing organ problems or even failure.

3. The amino acid sequence is:
1 dssyttlqrv aalersgmqi srhslvssyl almefsgnam trdasravlr fvtvta
Translates as:
Aspartic acid, serine, serine, tyrosine, threonine, threonine, leucine, glutamine, arginine, valine.

4. Citation:
Author: Kobayashi,Y. and Elsawy,H.B.
Title: A year-round monitoring of verotoxin genes from feces of dairy
           cattle
Journal: Published Only in Database (2006)

5. Nucleotide sequence:
CGGACAGTAGTTATACCACGTTACAGCGTGTTGCGGGGATCAGTCGTACGGGGATGCAGA  60        
CGGACAGTAGTTATACCACGTTACAGCGTGTTGCGGGGATCAGTCGTACGGGGATGCAGA  60
TAAATCGCCATTCGTTGACTACTTCTTATCTGGATTTAATGTCGCATAGCGGAACCTCAC  120       
TAAATCGCCATTCGTTGACTACTTCTTATCTGGATTTAATGTCGCATAGCGGAACCTCAC  120
TGACGCAGTCTGTGGCAAGAGCGATGTTACGGTTTGTCACTGTGACAGCAG  171
TGACGCAGTCTGTGGCAAGAGCGATGTTACGGTTTGTCACTGTGACAGCAG 171

Comments

  1. Hi Karley,
    I thought your selected protein was really interesting. I wonder how closely verotoxin is to E.coli. I would be interested in why the cow produces verotoxin, is there any benefits to producing it? I also wonder how it gets into humans. Good post!

    ReplyDelete

Post a Comment