Lab #4 Blast by Kevin Gomez
Versutoxin
Figure 1. The blue mountain funnel web spider (Hydronyche Versuta). The Versutoxin associated with this spider is not known to be fatal to humans. 1 out of 9 cases of people bitten from this spider had been reported to have serious symptoms due to a higher dose injected by the spider.
Why Versutoxin?
The reason I chose Verusotoxin was because i always watch documentaries on venomous bites/stings amongst humans and it's crazy how much damage something so small can do to a human that is significantly bigger.
Amino Acid Sequence (first 10)
Serine, Cysteine, Glutamine, Serine, Threonine, Isoleucine, Serine, Alanine, Leucine, Methionine.
Nucleotide Sequence
tgcgcgaaaaaacgcaactggtgcggcaaaaccgaagattgctgctgcccgatgaaatgc
gtgtatgcgtggtataacgaacagggcagctgccagagcaccattagcgcgctgtggaaa
aaatgc
Citation
AUTHORS: Brown,M.R., Sheumack,D.D., Tyler,M.I. and Howden,M.E.
TITLE: Amino acid sequence of versutoxin, a lethal neurotoxin from the
venom of the funnel-web spider Atrax versutus
JOURNAL: Biochem. J. 250 (2), 401-405 (1988)
You know, you're the second person I've come across that was fascinated about poison and toxin taking out other organisms. Kind of says something about us doesn't it? Nah im just kidding but overall your post was structured pretty well and was concise but very dense. One suggestions would be shortening your figure captions but other than that, good job!
ReplyDeleteThese blue mountain funnel web spiders are huge! I thought the big ones had some type of venom, but I didn't know it was deadly. I thought the small ones are the ones that can kill people. Or am I thinking of scorpions. Any ways, have you watched this guy on YouTube that goes around getting stung by insects with the most painful stings? I asked because you mentioned you watched the documentary on bites. Great post!
ReplyDeleteI have also watch several documentaries on spiders and also find is interesting how they are able to badly damage or even kill with just a single bite. Learning about this protein is also very useful to create antidotes or can be useful in understanding how to act if we were to ever get bitten by one. It would also be interesting to learn if it is possibly to lower the chances of getting a fatal bite by maybe eating certain foods or wearing certain clothes beforehand.
ReplyDelete