Lab #4 BLAST by Severin Robins
What protein did you search for?
What specific protein did you select (be careful here – a search for insulin will also give you results for insulin receptors and many other insulin-related molecules)?
What is the amino acid sequence that codes for this protein? Cut and paste from the database and put these search results (or no more than the first 15 typed lines) in your lab report.
Copy and paste the citation of the paper from which the data are drawn; you will need the authors, title, and journal. If there is more than one reference cited, use only the first.
What is the nucleotide sequence that codes for this protein? Cut and paste from the database and put these search results (or no more than the first 15 typed lines) in your post.
I searched for the protein Cas9 which is part of the adaptive immune system used by bacteria that provides protection against viruses. I chose this protein because it is apart of CRISPR which is something that was recently discovered and has to potential to revolutionize medicine and other fields of science.
Watch the link below if you want to learn more! Kurzgesagt - In a Nutshell does a great job of explaining what CRISPR is, and the possible ramifications of it.
What specific protein did you select (be careful here – a search for insulin will also give you results for insulin receptors and many other insulin-related molecules)?
Type II CRISPR RNA guided endonuclease Cas9
What is the amino acid sequence that codes for this protein? Cut and paste from the database and put these search results (or no more than the first 15 typed lines) in your lab report.
Tyr-Phe-Ser-Leu-Phe-Phe-Ile-Ile-Tyr-Pro-Asn-Leu-His-Pro-Val
Translate the first 10 amino acids from this code into the amino acid names.
Tyrosine-Phenylalanine-Serine-Leucine-Phenylalanine-Phenylalanine-Isoleucine-Isoleucine-Tyrosine-Proline
T, G. (2015). Complete genome sequence of Finegoldia magna, an anaerobic opportunistic pathogen. Epub. doi:10.1093/dnares/dsm030
What is the nucleotide sequence that codes for this protein? Cut and paste from the database and put these search results (or no more than the first 15 typed lines) in your post.
ATGAAAAGCGAAAAAAAATATTATATCGGATTGGATGTAGGTACTAATAGTGTAGGATGGGCTGTGACTG ACGAATTCTATAATATTCTTAGAGCCAAAGGAAAAGATTTGTGGGGAGTAAGATTATTTGAAAAAGCAGA CACTGCAGCAAACACAAGAATATTTAGAAGTGGTAGAAGAAGAAACGACAGAAAAGGTATGCGTCTTCAA ATTTTGAGAGAAATTTTTGAAGATGAAATCAAAAAGGTTGACAAAGACTTCTATGACAGACTTGATGAAA GCAAATTCTGGGCTGAAGACAAGAAAGTATCTGGGAAATATTCGTTATTTAATGATAAAAATTTCAGCGA CAAGCAATATTTTGAAAAGTTTCCTACTATTTTTCATCTTAGAAAATATTTAATGGAAGAACATGGAAAA GTAGACATTAGATACTATTTTCTAGCTATCAATCAAATGATGAAAAGAAGGGGACATTTTCTAATAGATG GTCAGATTTCTCACGTTACAGATGATAAACCATTAAAAGAACAACTTATTCTATTAATAAATGATTTATT AAAAATCGAATTAGAAGAAGAGCTTATGGATTCGATATTTGAAATTTTGGCGGATGTGAACGAGAAAAGA ACAGACAAGAAAAACAATCTAAAAGAGCTTATAAAAGGACAAGATTTTAATAAACAAGAAGGTAACATCC TAAACTCGATTTTTGAATCAATAGTTACTGGTAAAGCAAAAATAAAAAATATAATTTCAGATGAAGACAT TCTTGAAAAAATAAAGGAAGATAACAAGGAAGATTTCGTTCTTACAGGAGATAGCTACGAGGAAAATCTC CAATATTTTGAGGAAGTTTTACAAGAAAACATAACATTGTTTAACACACTTAAATCAACATATGATTTTT TAATCCTTCAATCTATTTTAAAAGGTAAGAGCACACTTTCTGATGCACAAGTCGAACGATACGATGAACA TAAAAAAGACCTCGAAATACTTAAAAAAGTAATAAAAAAATACGATGAAGATGGAAAATTGTTCAAGCAA
Prokaryotes can do truly amazing things. I did some reading about CRISPR and it looks like it was actually first discovered in archaea, then bacteria. I wonder what else is waiting for us in all of the unstudied archaea? Are we trying to use the idea of creating DNA sequences with pieces of DNA from viruses to try and prevent humans from ever having to fight off diseases? I also saw some stuff about preventing or fixing mutations in DNA, but I wasn't totally sure what scientists are thinking of taking from bacteria in order to make that happen?
ReplyDelete